Review



grb2 3972s  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc grb2 3972s
    Grb2 3972s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 266 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41819264-232-34-39
    Average 95 stars, based on 266 article reviews
    grb2 3972s - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Staining:

    Article Title: Physalin A Suppresses Human Oral Squamous Carcinoma Cell Migration and Invasion Through Inhibiting Grb2/Ras and MMP/uPA Signaling Pathways.
    Article Snippet: The quantified proteins were electrophoretically separated by 8-12% SDSPAGE gel (based on different KDa), and were transferred to polyvinylidene difluoride (PVDF; Cat. No. IPVH00010; Merck Millipore, Burlington, MA, USA) membranes, which were blocked with 5% albumin. .. The membranes were then stained using primary antibodies [anti- plasminogen activator inhibitor 1 (PAI-1; sc-5297; Santa Cruz Biotechnology), -uPA (sc-59727; Santa Cruz Biotechnology), -E-cad (sc-374067; Santa Cruz Biotechnology), -α-tubulin (α-tub; sc-8035; Santa Cruz Biotechnology), -MMP-1 (sc21731; Santa Cruz Biotechnology), -MMP-2 (sc-13595; Santa Cruz Biotechnology), -MMP-3 (sc-21732; Santa Cruz Biotechnology), -MMP-9 (sc-393859; Santa Cruz Biotechnology), -tissue inhibitor of metalloprotease (TIMP1; sc-365905; Santa Cruz Biotechnology), -TIMP-2 (sc21735; Santa Cruz Biotechnology), -p-IKK (p-IKK; sc293135; Santa Cruz Biotechnology), -IKK (sc-8032; Santa Cruz Biotechnology), -p-IκB (sc-8404; Santa Cruz Biotechnology), -IκB (sc-1643; Santa Cruz Biotechnology), -NF-κB p65 (sc-8008; Santa Cruz Biotechnology), -NF-κB p50 (sc-8414; Santa Cruz Biotechnology), -p-ERK (9911; Cell Signaling Technology), -ERK (9911; Cell Signaling Technology), -p-c-Jun N-terminal kinase (-p-JNK; 4668; Cell Signaling Technology), -JNK (9252; Cell Signaling Technology), -p-p38 (9211; Cell Signaling Technology), -p38 (9212; Cell Signaling Technology), -p-c-Jun (3270; Cell Signaling Technology), -c-Jun (9165; Cell Signaling Technology), -Grb2 (3972; Cell Signaling Technology), -Ras (3965; Cell Signaling Technology), -p-PI3K (4228; Cell Signaling Technology), -PI3K (4292; Cell Signaling Technology), -p-Akt (9271; Cell Signaling Technology), -Akt (9272; Cell Signaling Technology), -PCNA (sc-56; Santa Cruz Biotechnology) and -β-actin (sc-47778; Santa Cruz Biotechnology)] in 4°C overnight. ..

    Article Title: Physalin A Suppresses Human Oral Squamous Carcinoma Cell Migration and Invasion Through Inhibiting Grb2/Ras and MMP/uPA Signaling Pathways
    Article Snippet: The quantified proteins were electrophoretically separated by 8-12% SDS-PAGE gel (based on different KDa), and were transferred to polyvinylidene difluoride (PVDF; Cat. No. IPVH00010; Merck Millipore, Burlington, MA, USA) membranes, which were blocked with 5% albumin. .. The membranes were then stained using primary antibodies [anti- plasminogen activator inhibitor 1 (PAI-1; sc-5297; Santa Cruz Biotechnology), -uPA (sc-59727; Santa Cruz Biotechnology), -E-cad (sc-374067; Santa Cruz Biotechnology), -α-tubulin (α-tub; sc-8035; Santa Cruz Biotechnology), -MMP-1 (sc-21731; Santa Cruz Biotechnology), -MMP-2 (sc-13595; Santa Cruz Biotechnology), -MMP-3 (sc-21732; Santa Cruz Biotechnology), -MMP-9 (sc-393859; Santa Cruz Biotechnology), -tissue inhibitor of metalloprotease (TIMP-1; sc-365905; Santa Cruz Biotechnology), -TIMP-2 (sc-21735; Santa Cruz Biotechnology), -p-IKK (p-IKK; sc-293135; Santa Cruz Biotechnology), -IKK (sc-8032; Santa Cruz Biotechnology), -p-IκB (sc-8404; Santa Cruz Biotechnology), -IκB (sc-1643; Santa Cruz Biotechnology), -NF-κB p65 (sc-8008; Santa Cruz Biotechnology), -NF-κB p50 (sc-8414; Santa Cruz Biotechnology), -p-ERK (9911; Cell Signaling Technology), -ERK (9911; Cell Signaling Technology), -p-c-Jun N-terminal kinase (-p-JNK; 4668; Cell Signaling Technology), -JNK (9252; Cell Signaling Technology), -p-p38 (9211; Cell Signaling Technology), -p38 (9212; Cell Signaling Technology), -p-c-Jun (3270; Cell Signaling Technology), -c-Jun (9165; Cell Signaling Technology), -Grb2 (3972; Cell Signaling Technology), -Ras (3965; Cell Signaling Technology), -p-PI3K (4228; Cell Signaling Technology), -PI3K (4292; Cell Signaling Technology), -p-Akt (9271; Cell Signaling Technology), -Akt (9272; Cell Signaling Technology), -PCNA (sc-56; Santa Cruz Biotechnology) and -β-actin (sc-47778; Santa Cruz Biotechnology)] in 4°C overnight. ..

    other:


    Article Title: Exploring chamazulene as a novel therapeutic agent for breast cancer in silico and in vitro : apoptosis induction, cell cycle regulation, and antimetastatic effects
    Article Snippet: Primary antibodies against NFKB1 (catalog no. 13586, 1:1,000 dilution), MAPK14 (catalog no. 8690, 1:1,000 dilution), and GRB2 (catalog no. 3972, 1:1,000 dilution) were from Cell Signaling Technology (Danvers, MA, United States).

    Western Blot:

    Article Title: APOA1 binding protein promotes lymphatic cell fate and lymphangiogenesis by relieving caveolae-mediated inhibition of VEGFR3 signaling.
    Article Snippet: .. Antibodies to the following proteins were used for Western blot analyses: pAKT (S473, CST #4060S; 1:1000), AKT (CST #4685S; 1:1000), pERK1/2 (CST #4370S; 1:1000), ERK1/2 (CST #4695S; 1:1000), GAPDH (CST #2118S; 1:000), Caveolin-1 (CST #3238S; 1:1000), Flotillin-1 (Abcam #ab41927; 1:500), GFP (Invitrogen #MA1-952; 1:1000), VEGFR2 (CST #2479L; 1:1000), pY1175-VEGFR2 (CST #2478S; 1:1000), 4G10 (CST #96215S; 1:1000), GRB2 (CST #3972S; 1:1000), and VEGFR3 (Santa cruz #SC321, 1:400). ..

    Chromatin Immunoprecipitation:

    Article Title: Temporal photoproximity labeling of ligand-activated EGFR neighborhoods using MultiMap.
    Article Snippet: .. 3 nature portfolio | reporting sum m ary April 2023 Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Antibodies were purchased including: EGFR (Thermo Scientific, MA5-13319; Cell Signaling Technology, 4267, 2239, 2256), Rab11a (Cell Signaling Technology, 2413), STAT2 (Cell Signaling Technology, 72604), EPS15 (Cell Signaling Technology, 12460), SHP1 (Cell Signaling Technology, 26516), ITGA2 (Bethyl Laboratories, A305-211A-T; Cell Signaling Technology, 88228), Dynamin I/II (Cell Signaling Technology, 2342), SRC (Cell Signaling Technology, 2109), ARF6 (Cell Signaling Technology, 5740), PTPRF (Cell Signaling Technology, 61611), β-actin (Santa Cruz Biotechnology, sc-47778), CD44 (Cell Signaling Technology, 3578), Tid1 (Cell Signaling Technology, 4775), β-catenin (Cell Signaling Technology, 8480), GRB2 (Cell Signaling Technology, 3972), STAT3 (Cell Signaling Technology, 12640), Phospho-EGFR (Tyr1045) (Cell Signaling Technology, 2237), Phospho-EGFR (Tyr1086) (Cell Signaling Technology, 2220S), Phospho-EGFR (Tyr845) (Cell Signaling Technology, 2231), Phospho-EGFR (Tyr992) (Cell Signaling Technology 2235), Phospho-EGFR (Tyr1068) (Cell Signaling Technology, 3777), Phospho-EGFR (Tyr978) (Cell Signaling Technology, 3790), Phospho-EGFR (Tyr1173) (Cell Signaling Technology, 4757, 2244), Phospho-p44/42 MAPK (pERK) (Cell Signaling Technology, 4370, 9101), P44/42 MAPK (ERK1/2) (Cell Signaling Technology, 4695), Phospho-Akt (S473) (Cell Signaling Technology, 4058), Phospho-MEK (S217/221) (Cell Signaling Technology, 9154), Phospho-PLCy (Y783) (Cell Signaling Technology, 2821), Akt (Cell Signaling Technology, 4691), Phospho-EGFR (Y1068) Fluorescein-conjugated Antibody (R&D Systems, IC3570F), Phospho-EGFR Pathway Antibody panel (Cell Signaling Technology, 9789). ..

    Flow Cytometry:

    Article Title: Temporal photoproximity labeling of ligand-activated EGFR neighborhoods using MultiMap.
    Article Snippet: .. 3 nature portfolio | reporting sum m ary April 2023 Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Antibodies were purchased including: EGFR (Thermo Scientific, MA5-13319; Cell Signaling Technology, 4267, 2239, 2256), Rab11a (Cell Signaling Technology, 2413), STAT2 (Cell Signaling Technology, 72604), EPS15 (Cell Signaling Technology, 12460), SHP1 (Cell Signaling Technology, 26516), ITGA2 (Bethyl Laboratories, A305-211A-T; Cell Signaling Technology, 88228), Dynamin I/II (Cell Signaling Technology, 2342), SRC (Cell Signaling Technology, 2109), ARF6 (Cell Signaling Technology, 5740), PTPRF (Cell Signaling Technology, 61611), β-actin (Santa Cruz Biotechnology, sc-47778), CD44 (Cell Signaling Technology, 3578), Tid1 (Cell Signaling Technology, 4775), β-catenin (Cell Signaling Technology, 8480), GRB2 (Cell Signaling Technology, 3972), STAT3 (Cell Signaling Technology, 12640), Phospho-EGFR (Tyr1045) (Cell Signaling Technology, 2237), Phospho-EGFR (Tyr1086) (Cell Signaling Technology, 2220S), Phospho-EGFR (Tyr845) (Cell Signaling Technology, 2231), Phospho-EGFR (Tyr992) (Cell Signaling Technology 2235), Phospho-EGFR (Tyr1068) (Cell Signaling Technology, 3777), Phospho-EGFR (Tyr978) (Cell Signaling Technology, 3790), Phospho-EGFR (Tyr1173) (Cell Signaling Technology, 4757, 2244), Phospho-p44/42 MAPK (pERK) (Cell Signaling Technology, 4370, 9101), P44/42 MAPK (ERK1/2) (Cell Signaling Technology, 4695), Phospho-Akt (S473) (Cell Signaling Technology, 4058), Phospho-MEK (S217/221) (Cell Signaling Technology, 9154), Phospho-PLCy (Y783) (Cell Signaling Technology, 2821), Akt (Cell Signaling Technology, 4691), Phospho-EGFR (Y1068) Fluorescein-conjugated Antibody (R&D Systems, IC3570F), Phospho-EGFR Pathway Antibody panel (Cell Signaling Technology, 9789). ..

    Magnetic Resonance Imaging:

    Article Title: Temporal photoproximity labeling of ligand-activated EGFR neighborhoods using MultiMap.
    Article Snippet: .. 3 nature portfolio | reporting sum m ary April 2023 Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Antibodies were purchased including: EGFR (Thermo Scientific, MA5-13319; Cell Signaling Technology, 4267, 2239, 2256), Rab11a (Cell Signaling Technology, 2413), STAT2 (Cell Signaling Technology, 72604), EPS15 (Cell Signaling Technology, 12460), SHP1 (Cell Signaling Technology, 26516), ITGA2 (Bethyl Laboratories, A305-211A-T; Cell Signaling Technology, 88228), Dynamin I/II (Cell Signaling Technology, 2342), SRC (Cell Signaling Technology, 2109), ARF6 (Cell Signaling Technology, 5740), PTPRF (Cell Signaling Technology, 61611), β-actin (Santa Cruz Biotechnology, sc-47778), CD44 (Cell Signaling Technology, 3578), Tid1 (Cell Signaling Technology, 4775), β-catenin (Cell Signaling Technology, 8480), GRB2 (Cell Signaling Technology, 3972), STAT3 (Cell Signaling Technology, 12640), Phospho-EGFR (Tyr1045) (Cell Signaling Technology, 2237), Phospho-EGFR (Tyr1086) (Cell Signaling Technology, 2220S), Phospho-EGFR (Tyr845) (Cell Signaling Technology, 2231), Phospho-EGFR (Tyr992) (Cell Signaling Technology 2235), Phospho-EGFR (Tyr1068) (Cell Signaling Technology, 3777), Phospho-EGFR (Tyr978) (Cell Signaling Technology, 3790), Phospho-EGFR (Tyr1173) (Cell Signaling Technology, 4757, 2244), Phospho-p44/42 MAPK (pERK) (Cell Signaling Technology, 4370, 9101), P44/42 MAPK (ERK1/2) (Cell Signaling Technology, 4695), Phospho-Akt (S473) (Cell Signaling Technology, 4058), Phospho-MEK (S217/221) (Cell Signaling Technology, 9154), Phospho-PLCy (Y783) (Cell Signaling Technology, 2821), Akt (Cell Signaling Technology, 4691), Phospho-EGFR (Y1068) Fluorescein-conjugated Antibody (R&D Systems, IC3570F), Phospho-EGFR Pathway Antibody panel (Cell Signaling Technology, 9789). ..



    Similar Products

    lentiviral particles carrying shrna targeting grb2  (Genechem)
    86
    Genechem lentiviral particles carrying shrna targeting grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/ags+cell+gc+lines/pmc13157854-91-0-18
    Average 86 stars, based on 1 article reviews
    lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    grb2 immunohistochemistry  (Human Protein Atlas)
    86
    Human Protein Atlas grb2 immunohistochemistry
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2 Immunohistochemistry, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/grb2+immunohistochemistry/pmc13157854-107-50-54
    Average 86 stars, based on 1 article reviews
    grb2 immunohistochemistry - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    stable cell lines lentiviral particles carrying shrna targeting grb2  (Genechem)
    86
    Genechem stable cell lines lentiviral particles carrying shrna targeting grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Stable Cell Lines Lentiviral Particles Carrying Shrna Targeting Grb2, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/ags+cell+gc+lines/10__2147_slash_jhc__s581550-81-3-24
    Average 86 stars, based on 1 article reviews
    stable cell lines lentiviral particles carrying shrna targeting grb2 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    anti grb2  (Proteintech)
    93
    Proteintech anti grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Anti Grb2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41901226-133-103-108
    Average 93 stars, based on 1 article reviews
    anti grb2 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    grb2 3972s  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc grb2 3972s
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2 3972s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41819264-232-34-39
    Average 95 stars, based on 1 article reviews
    grb2 3972s - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    grb2  (Cell Signaling Technology Inc)
    95
    Cell Signaling Technology Inc grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41760308-88-144-146
    Average 95 stars, based on 1 article reviews
    grb2 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    k ras  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology k ras
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    K Ras, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41651299-183-39-64
    Average 96 stars, based on 1 article reviews
    k ras - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    grb2  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology grb2
    <t>GRB2</t> is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.
    Grb2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grb2/GRB2+Antibody/pm41651299-183-34-64
    Average 96 stars, based on 1 article reviews
    grb2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing, Immunohistochemistry

    Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing, Biomarker Discovery

    Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Expressing

    PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

    Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Lentiviral particles carrying shRNA targeting GRB2 (shGRB2-1: CAGATATTCCTGCGGGACATA, shGRB2-2: CGGCTTCATTCCCAAGAACTA) and negative control (shGRB2-NC: TTCTCCGAACGTGTCACGT) were constructed by GeneChem (Shanghai, China).

    Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry

    GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells. The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001, “****” P < 0.0001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing, Immunohistochemistry

    Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 expression and poor prognosis of HCC patients. ( A ) GRB2 expression vs histological grade; ( B ) Association between GRB2 expression and TNM stage; ( C ) Overall and relapse-free survival curves of HCC patients; ( D ) The ROC curve of GRB2 in the diagnosis of HCC. “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing, Biomarker Discovery

    Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Correlation between GRB2 and hypoxia. ( A ) The correlation between GRB2 and hypoxia gene HIF-1α expression.; ( B ) The correlation between GRB2 and hypoxia gene VEGFA expression.; ( C ) GSVA analysis of GRB2 in ICGC-LIRI; ( D ) Hypoxia score and GRB2 expression. “****” P < 0.0001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Expressing

    PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: PI3K/AKT pathway contributes to sorafenib resistance under hypoxia. ( A ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM vs DMSO, hypoxia, 24 h); ( B ) Western blotting of PI3K, AKT, p-AKT (sorafenib 5 μM ± LY294002 20 μM, hypoxia, 24 h); ( C ) CCK-8 viability (sorafenib 0,5,10,15,20 μM ± LY294002 20 μM, hypoxia, 24 h); ( D ) Wound healing (sorafenib 5 μM ± LY294002, hypoxia, 24 h); ( E ) Flow cytometry (sorafenib 5 μM ± LY294002, hypoxia, 24 h).The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Western Blot, CCK-8 Assay, Flow Cytometry

    Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Journal: Journal of Hepatocellular Carcinoma

    Article Title: GRB2 Promotes Sorafenib Resistance in Hepatocellular Carcinoma Cells Under Hypoxia by Activating the PI3K/AKT Signaling Pathway

    doi: 10.2147/JHC.S581550

    Figure Lengend Snippet: Down-regulation of GRB2 suppressed PI3K/AKT pathway in HCC cells. ( A ) GRB2 knockdown efficiency verified by Western blotting and RT-qPCR in stable cell lines; ( B ) CCK-8 viability (sorafenib 0,5,10,15,20 μM, hypoxia, 24 h) in shGRB2-NC, shGRB2-1, shGRB2-2; ( C ) Wound healing (sorafenib 5 μM, hypoxia, 24 h); ( D ) Flow cytometry (sorafenib 5 μM, hypoxia, 24 h); ( E ) Western blotting of GRB2, PI3K, AKT, p-AKT (sorafenib 5 μM, hypoxia, 24 h). The data presented here are based on three independent experiments. “*” indicates P < 0.05, “**” P < 0.01, “***” P < 0.001.

    Article Snippet: Figure 1 GRB2 is highly expressed in HCC. ( A ) The expression of GRB2 in pan-cancer; ( B ) Paired analysis of GRB2 transcript levels in HCC and normal tissues; ( C ) The ranking of GRB2 expression in GEO dataset GSE76427 ; ( D ) Representative images of GRB2 immunohistochemistry in The Human Protein Atlas database; ( E ) GRB2 expression in immortalized hepatocytes and four HCC cells.

    Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Stable Transfection, CCK-8 Assay, Flow Cytometry